Journal of Cellular and Molecular Physiology

ISSN: 2574-4046

Impact Factor: 0.638

VOLUME: 3 ISSUE: 2

Profile of Isoforms of Serum PLCß in Congolese Children in a Context of Sickle Cell Pain


Corresponding Author

Ghislain LOUBANO-VOUMBI*(PhD)

E-Mail: ghisloubano@yahoo.fr  or ghisloubano@gmail.com

Tel:  00242 06 647 10 93 or 00242 05301 62 07

Affiliation

Ghislain LOUBANO-VOUMBI*1, 2; Bademba CISSE3; Christ Harvain KAYA KIMPOLO2; Adonis Ordely Proven OSSEBI2

1. National Institute for Research in Health Sciences -Congo Brazzaville

2. General Hospital of Dolisie-Congo Brazzaville

3. Gamal Abdel Nasser University of Conakry - Guinea Conakry

Citation

GHISLAIN LOUBANO-VOUMBI, Profile of Isoforms of Serum PLCß in Congolese Children in a Context of Sickle Cell Pain(2019)Journal of Cellular and Molecular Physiology 3(2)

Abstract

Background : Pain associated with vaso-occlusive crisis is therefore a major problem in the management of sickle cell patients. The objective of this work was to establish the profile of the expression of different isoforms of PLC ß likely to be a therapeutic target in sickle cell pain.

Methods: After evaluation of pain using a Wong-Baker face scale. Serum markers of endothelial dysfunction (i-CAM, v-CAM) as well as inflammatory markers (IL-6, TNF-alpha) were measured by ELISA. The profile of different isoforms of PLC β was established by RT-PCR. Comparisons were made by chi-square analysis and the t-student test and a one-way ANOVA where appropriate.

Results: A total of 90 patients were recruited. Concentrations of serum i-CAM, v-CAM, IL-6, and TNF-alpha  showed significant differences between groups of subjects with Hb AA and those with Hb SS (p˂0.0001, n = 90 ). In addition, differences were noted between subjects with Hb SS with painful crisis and those without painful crisis for all markers (p˂0.0001, n = 60) except for TNF-Alpha (P = 0.11; n = 60). Finally, our data showed an expression of PLCß1 in the three groups of our study (p> 0.5, n = 90). Then, PLCß2 and PLCß4 are overexpressed in subjects with Hb SS with or without seizure. The statistical analysis shows a significant difference with the group of subjects carrying Hb AA (p˂0.0001, n = 90). However, we noted that PLCß3 is overexpressed only in subjects with Hb SS with pain crisis (p˂0.0001, n = 90).

Conclusion: These data suggest that the enzyme PLCß3 is pro-nociceptive, which could be a therapeutic target in sickle cell pain.

Keywords: Painful crisis; Sickle cell; isoforms of PLC ß ; Congolese children

Introduction

Pain is an often permanent symptom of people with sickle cell disease and is a predictor of disease severity and mortality (1). Chronic pain associated with vaso-occlusive crisis is therefore a major problem in the management of sickle cell patients (2, 3). The neurobiology of chronic pain in patients with sickle cell disease is poorly understood (4, 5, 6). In addition, opioids and non-opioids are used to treat sickle cell pain; opioids are associated with many side effects with the potential for dependence [7]. Non-opioids, particularly nonsteroidal anti-inflammatory drugs, are not sufficiently effective against severe pain and are also associated with many adverse effects [8].

Emerging data has identified several cellular and molecular targets that contribute to nociceptive activity in sickle cell disease. These targets may be located at the periphery, suggesting that the microenvironment of sickle-cell red blood cells can activate pain transmission from the periphery and directly affect the central nervous system (9). In addition, it would be more interesting to specify these molecular targets to better optimize the treatment of different pain states (10).

The phospholipase C (PLC) family comprises several isoforms, such as PLCβ, γ, δ and ε, which are linked to membrane receptors mediating intracellular signaling cascades (11, 12). PLC is expressed in the neurons of the dorsal root ganglion (13, 14), which could make this signaling pathway a therapeutic of pain.

Numerous physiological and functional studies have shown that PLCß signaling is involved in a variety of sensory functions by specific or selective coupling to G protein-coupled receptors (9). However, despite indications of an important role played by PLCß signaling pathways in sensory signal transduction, only in vitro evidence that implicates them in primary sensory neurons exists (14). In addition, no clinical study to our knowledge has been conducted to evaluate the profile of serum PLCP in nociceptive and inflammatory pain, particularly in sickle cell disease. Understanding the possible pathophysiological mechanisms of pain in the vaso-occlusive crisis period can lead to innovative treatment strategies in sickle cell disease.

Thus, the aim of this work was to establish the profile of the expression of the different isoform of the PLC β likely to be a therapeutic target in sickle cell pain.

Materials & Methods

2.1. Study population and ethics.

The subjects were recruited from March 2019 to June 2019 during routine visits to three hospitals in the city of Dolisie (Congo-Brazzaville). A total of 90 children aged 6 months to 5 years were recruited on the basis of the interview and the evaluation of severe pain requiring treatment by a physician in the emergency department or hospitalization. Written consents were obtained from the parents of the recruited subjects. The study was conducted in accordance with the Helsinki Declaration and was approved by the Congo Committee of Ethics in Health Sciences. They were divided into three groups, a group of cases consisting of 30 subjects carrying SS hemoglobin in the presence of painful crises, 30 control subjects carrying SS hemoglobin in the absence of painful crisis and 30 control subjects carrying AA Hemoglobin. The subjects included in this study are those with SS or AA electrophoresis hemoglobin profile, not transfused for more than three months, without comorbidity (diabetes, renal failure, cardiovascular disease).

2.2. Assessment of pain

Pain was defined as the occurrence of pain related to sickle cell disease within 72 hours prior to hospitalization or medication with analgesics. Pain in children was assessed prior to venipuncture and related to the procedure using a Wong-Baker Faces scale. The Faces scale is a reliable scale with six drawn faces and numbers from 0 to 10 to indicate the intensity of the pain. Research indicates that the Wong-Baker Faces Scale is also the preferred method of assessing pain in children. (15)

2.3. Sample collection.

The blood samples were taken under optimum conditions of preference, the fasting of which was not compulsory. After asepsis, a clear venous puncture was performed preferably at the bend of the elbow. The aspirated blood volume was about 5ml. The samples obtained in the EDTA tubes for hemoglobin electrophoresis were analyzed in our research unit and the serum obtained after centrifugation was intended for biomarker assays for the expression of PLCß genes.

2.4. Protein analyzes by ELISA

Determination of the concentrations of i-CAM , v-CAM markers (Invitrogen, USA); IL-6 and TNF-alpha (Abcam, USA) were made using the enzyme-linked immunosorbent sandwich assay (ELISA) technique as described by the respective manufacturers.

2.5. Gene expression by PCR

Total RNA was extracted using RNeasy Plus Micro and Mini kits (Qiagen). Purity and RNA concentration were assessed using a Nanodrop spectrophotometer. Then, reverse transcription was performed using iScript kits (Bio-Rad) according to the manufacturer's instructions. The primers (Table 1) and 5 ng of cDNA were used for PCR amplification in a final volume of 25 μl. After denaturation at 94 ° C., 45 DNA amplification cycles were carried out using Taq DNA polymerase (Invitrogen) at 94 ° C. for 45 seconds, at 55 ° C. for 30 seconds and at 72 ° C. C for 90 seconds. A final extension step was carried out for 10 min at 72 ° C. Amplicons were electrophoresed on agarose gels stained with 3% ethidium bromide. The sizes of the PCR products were estimated using the Gene Ruler low-density DNA scale (Thermoscientific) and compared to the theoretical size of the amplicon.

Table 1

Gene

Forward (5’ → 3’)

Reverse (5’ → 3’)

 

PLCβ1

GGCACCTGCCAAAACAGAAG

CTGCAGCTTGGGCTTTTCAT

PLCβ2

GTGCCCCTGAAATGAAACGG

   GGGCAGGAGGACCTGTTTA

PLCβ3

GTGCCCCTGAAATGAAACGG

TGCAGCTTCAGCTTCGTGTA

PLCβ4

GGAAGTGCCCTCTTTCTTGC

GCCTTCACTCTTCCACGTCA

2.6. Statistical analyzes

Statistical analysis was performed using Graph Pad Software version 2005 and Microsoft Excel version 2007. Comparisons were made by chi-square and t-student analysis and single-channel ANOVA where appropriate. The confidence index was 95%.

Results

3.1. Characteristics of the Study Population

Table 2 shows the age, sex, and hematologic characteristics of subjects with AA hemoglobin and SS hemoglobin in the presence and absence of pain. Significant differences in the age parameter and hematological parameters between the different groups were noted (Table 2).

Caracteristics

Hb AA

Hb SS (-P)

Hb SS (+P)

P-value

 

Number

30

30

30

-

Sex (M/F)

35/25

14/16

12/15

-

Age (an)

4.02±08*

2.1±0.3

2.0±0.1

0,01

Hb level (g/dl)

13.5±1.1*

8.17±1.3

7.1±1.5

0,02

RBC (106/mm3)

4.41±1.2*

3.4±0.58

3.1±0.4

0,04

WBC (103/mm3)

5.48±1.2

12.2±3.9**

16.33±6.9**

0,001

PLT   (103/mm3)

266±77.4

488±70.33*

441±101.2*

0,03

Hb SS (-P) = Subjects carrying SS hemoglobin in the absence of pain.

Hb SS (+P) =Subjects carrying SS hemoglobin in the presence of pain. 

Hb AA = subjects carrying AA hemoglobin.

RBC = Red Blood Cells.

WBC = White blood cells.                                 

PLT: blood platelets.

 

3.2. Endothelial Dysfunction Markers

Figure 1 shows the profile of serum v-CAM and i-CAM concentrations for subjects in three groups. Our results showed significant differences between the concentrations of v-CAM and i-CAM in subjects with SS hemoglobin compared to subjects with AA hemoglobin (p˂0.0001, n = 90); and, on the other hand, we noted significant differences between subjects carrying SS hemoglobin during a painful crisis and no painful crisis (p˂0.0001, n = 90). These data confirm that the presence of SS hemoglobin increases the concentration of v-CAM and i-CAM biomarkers thus suggesting endothelial dysfunction. In addition, the pain crisis increases the concentration of these biomarkers.

Biomarkers of vascular adhesion

Figure 1: Biomarkers of vascular adhesion.

V-CAM: vascular cell adhesion molecule. I-CAM: InterCellular Adhesion Molecule

 

3.3. Profile of Inflammatory Markers And Pain

Figure 2 shows the profile of serum cytokine (IL-6 and TNF-alpha) concentration in the population of our study. Our data showed statistically significant differences between the groups, except for TNF-alpha between subjects in the group during Hb SS with or without a painful crisis.

Profile of inflammatory markers and pain

Figure 2: Profile of inflammatory markers and pain.

P <0.0001 between Hb AA subjects and Hb SS (-P) subjects; P<0.0001 between Hb AA and Hb SS (+P) and p <0.02 between Hb SS (-P) and Hb SS (+P) for IL-6.

P <0.0001 between Hb AA subjects and Hb SS (+P) subjects; P<0.018 between Hb AA subjects and Hb SS (-P) subjects and p = 0.11 between Hb SS (+P) and Hb SS (-P) subjects for TNF-alpha.

 

3.4. Gene Profile of PCLß

In order to evaluate the gene expression of serum phospholipase C beta, we determined the level of mRNA of different types of PLCß in the three groups (Figure 3). Our data showed an expression of PLCß1 in the three groups of our study (p> 0.5, n = 90). Then, PLCß2 and PLCß4 are overexpressed in subjects with Hb SS with or without seizure. The statistical analysis shows a significant difference with the group of subjects carrying Hb AA (p˂0.0001, n = 90). However, we noted that PLCß3 is overexpressed only in subjects with Hb SS with pain crisis (p˂0.0001, n = 90).

Expression of different types of PLCß

Figure 3: Expression of different types of PLCß

 

Discussion

The aim of our work was to establish the profile of PLCß as a potential therapeutic target for pain in homozygous sickle cell patients during a vaso-occlusive crisis. We observed an abnormality of hematological constants in subjects with Hb SS with or without a painful attack. We also noted an increase in markers of endothelial dysfunction particularly v-CAM and i-CAM. Then, we observed an increase in the concentration of inflammatory markers including interleukin-6 and TNF alpha in subjects with Hb SS. Finally we observed that PLCß2 and PCLβ4 are expressed in SS homozygous sickle cell disease, however only PLCß3 was expressed in the period of pain crisis in homozygous sickle cell patients.

Previous clinical or animal model studies have consistently shown abnormal hematologic constants including anemia, leukocytosis and hyperthrombocytosis in homozygous sickle cell patients with multiple pathophysiological consequences (16, 17). Our data corroborate with these previous studies (16, 17); we observed a statistically significant difference between subjects carrying hemoglobin AA and those carrying hemoglobin SS (p ˂0.001). Significant differences were also noted between subjects with SS hemoglobin in the absence or in painful crisis (p˂0.001). In fact, sickle cell disease is an inflammatory disease of which one of the cellular markers of this inflammation is leucocytosis [18]. Increased numbers and activation of leukocytes are important mediators of inflammation in sickle cell disease. Leukocytes can adhere to each other, to sick or uncompleted erythrocytes, platelets and vascular endothelium [19]. Finally, we also suggest that sickling of red blood cells is responsible for the sensitization and recruitment of leukocytes (16, 18, 19).

Then, we noted a hyperthrombocytosis between sickle cell carriers carrying SS hemoglobin and those of AA homoglobin with a significant difference (p˂0.03), moreover we did not notice any difference between the subjects carrying the SS hemoglobin during or without a painful episode (p = 0.41). These data in agreement with those of Zhang et al (20) and that of Pakbaz and Wun (21) confirm that the activated platelets also secrete chemicals involved in GR-endothelium by pass and participate in the occurrence of painful crises.

Thus, we observed an increase in the concentration of i-CAM and v-CAM in subjects with SS hemoglobin during or without a pain crisis compared to those of hemoglobin AA. The statistical analysis also confirmed a significant difference (p˂0, 0001). Our results are in agreement with others who have suggested that vaso-occlusion is initiated by the adhesion of red blood cells [18, 19] and activated leukocytes [18] to the endothelium. In addition, platelet adhesion to endothelial cells leads to their activation and the expression of endothelial secretions of I-CAM and v-CAM [19].

Sickle cell disease is an inflammatory disease accompanied by the expression of several biomarkers in general and in particular by the production of pro-inflammatory cytokines (17, 18, and 19). In this study, we evaluated IL-6 and TNF-alpha. We noted an increase in the concentration of IL-6 and TNF-alpha in subjects with SS hemoglobin with or without a painful attack. The statistical analysis noted a difference between the group of subjects carrying AA hemoglobin and those carrying SS hemoglobin in the presence or absence of painful crisis (p˂0, 0001). These data are in agreement with those of the literature (20, 21, 22). These results suggest that endothelial dysfunction may be responsible for the inflammatory state observed with or without a painful attack.

Finally, we noted an overexpression of the PLCß2 and PLCß4 genes in homozygous sickle cell disease with or without pain. We particularly observed an overexpression of PLCß3 during a painful crisis in subjects with SS hemoglobin (p <0.0001). This overexpression of serum PLCß3 could be suggested as a biomarker of sickle cell pain in agreement with the results of several other studies in animals (23, 24). In fact, inhibition of PLCβ3 by local injection of U73122 into the posterior paw has been shown to attenuate acute and chronic inflammatory hyperalgesia induced by unilateral injection of carrageenan at the same site (25). These models clearly differ from the present study, which evaluates the expression of serum PLCß3 in humans and in addition, a pain of nociceptive and inflammatory nature. In addition, the apparent pro-nociceptive effect of PLCβ3 was also evident in studies of the role of this enzyme in opiate μ mediated responses (26, 27). Thus, this study reports a proof that the PLCß3 enzyme could be a "pro-nociceptive" and constitute a therapeutic target

Conclusion

In conclusion, we have reported that sickle cell disease is associated with upregulation of inflammatory plasma components on the one hand, on the other hand, in response to pain following vascular lesions caused by sickling of red blood cells and adhesion of blood cells to the vascular wall, our results suggest a possible pro-nociceptive activity of PLCß3 in sickle-cell pain crisis.


ABBREVIATIONS

Hb : hemoglobin

i-CAM  : InterCellular Adhesion Molecule

v-CAM : vascular cell adhesion molecule


COMPETING INTERESTS’ STATEMENT

The authors declare that they have no conflict of interest with the contents of this article.


AUTHOR CONTRIBUTIONS

Ghislain LOUBANO-VOUMBI and Bademba CISSE designed the project. Christ Harvain KAYA KIMPOLO, Adonis Ordely Proven OSSEBI and GLV performed all the experiments. Ghislain LOUBANO-VOUMBI participated in the data analysis. All authors have read and approved the manuscript written by Ghislain LOUBANO-VOUMBI.


References

  1. Platt OS, Thorington BD, Brambilla DJ, et al. Pain in sickle cell disease. Rates and risk factors. N Engl J Med. 1991;325:11-16 PMid:1710777

    View Article      PubMed/NCBI     
  2. Deepika S. Darbari, Kathleen J. Vaughan, Katherine Roskom, Cassie Seamon, Lena Diaw, Meghan Quinn, Anna Conrey, Alan N. Schechter, Jennifer A. Haythornthwaite, Myron A. Waclawiw, Gwenyth R. Wallen, Inna Belfer, James G. Taylor, VI. Central sensitization associated with fetal hemoglobin levels in adults with sickle cell anemia. Scand J Pain. 2017; 17: 279-286. doi: 10.1016/j.sjpain.2017.08.001 PMid:28969994

    View Article      PubMed/NCBI     
  3. Ballas SK, Gupta K, Adams-Graves P. Sickle cell pain: a critical reappraisal. Blood. 2012; 120(18):3647-3656. PMid:22923496

    View Article      PubMed/NCBI     
  4. Platt OS, Thorington BD, Brambilla DJ, et al. Pain in sickle cell disease. Rates and risk factors. N Engl J Med. 1991;325(1):11-16. PMid:1710777

    View Article      PubMed/NCBI     
  5. Tran H, Gupta M, and Gupta K. Targeting novel mechanisms of pain in sickle cell disease. Hematology Am Soc Hematol Educ Program. 2017 Dec 8; 2017(1): 546-555. doi: 10.1182/asheducation-2017.1.546 PMid:29222304

    View Article      PubMed/NCBI     
  6. Abdo S, Nuseir KQ, Altarifi AA, Barqawi M, Ayoub NM, Mukkatash TL . Management of Sickle Cell Disease Pain among Adolescent and Pediatric Patients. Brain Sci. 2019 ; 9(8): 182. doi: 10.3390/brainsci9080182 PMid:31366021

    View Article      PubMed/NCBI     
  7. Abdo S, Nuseir KQ, Altarifi AA, Barqawi M, Ayoub NM and Mukkatash TL. Management of Sickle Cell Disease Pain among Adolescent and Pediatric Patients. Brain Sci. 2019; 9(8): 182.doi: 10.3390/brainsci9080182 PMid:31366021

    View Article      PubMed/NCBI     
  8. Rees D.C., Olujohungbe A.D., Parker N.E., Stephens A.D., Telfer P., Wright J. Guidelines for the management of the acute painful crisis in sickle cell disease. Br. J. Haematol. 2003;120:744-752. doi: 10.1046/j.1365-2141.2003.04193.x PMid:12614204

    View Article      PubMed/NCBI     
  9. Straube A, Aicher B, Fiebich B L and Haag G. Combined analgesics in (headache) pain therapy: shotgun approach or precise multi-target therapeutics? BMC Neurol. 2011; 11: 43. PMid:21453539

    View Article      PubMed/NCBI     
  10. Kruse M, Vivas O, Traynor-Kaplan A, Hille B. Dynamics of Phosphoinositide-Dependent Signaling in Sympathetic Neurons J Neurosci. 2016 ; 36(4): 1386-1400. doi: 10.1523/JNEUROSCI.3535- 15.2016 PMid:26818524

    View Article      PubMed/NCBI     
  11. Exton JH. Regulation of phosphoinositide phospholipases by hormones, neurotransmitters, and other agonists linked to G proteins. Annu Rev Pharmacol Toxicol. 1996;36:481-509. PMid:8725399

    View Article      PubMed/NCBI     
  12. Rhee SG. Regulation of phosphoinositide-specific phospholipase C. Annu Rev Biochem. 2001;70:281-312 PMid:11395409

    View Article      PubMed/NCBI     
  13. Harden TK, Sondek J. Regulation of phospholipase C isozymes by ras superfamily GTPases. Annu Rev Pharmacol Toxicol. 2006; 46:355-379. PMid:16402909

    View Article      PubMed/NCBI     
  14. Lagercrantz J, Piehl F, Nordenskjöld M, Larsson C, Weber G. Expression of the phosphoinositide-specific phospholipase Cbeta3 gene in the rat. Neuroreport. 1995; 6:2542-2544. PMid:8741758

    View Article      PubMed/NCBI     
  15. Alyssa M. Schlenz, Catherine B. McClellan, Teresa R.M. Mark, Alvin D. McKelvy, Eve Puffer, Carla W. Roberts, Sarah M. Sweitzer, and Jeffrey C. Schatz. Sensitization to Acute Procedural Pain in Pediatric Sickle Cell Disease: Modulation by Painful Vaso-occlusive Episodes, Age, and Endothelin-1. J Pain. 2012 ; 13(7): 656-665. PMid:22633685

    View Article      PubMed/NCBI     
  16. Doupa D , Djite M , Gueye PM, Seck M , Faye BF , Seck SM , Diallo F , Ndiaye A , Samba A , Cisse F , Diatta A , Diagne I et Diop S. Profil biochimique et hématologique des patients drépanocytaires homozygotes en phase stationnaire au centre National de Transfusion Sanguine de Dakar. Int. J. Biol. Chem. Sci. 2017; 11(4): 1706-1715

    View Article           
  17. Tshilolo L, Wembonyama S, Summa V, Avvisati G. Hemogram findings in Congolese children with sickle cell disease in remission. Med Trop. 2010; 70(5-6):459-63.

  18. Nacoulma EW, Sakande J, Kafando E, Kpowbié ED, Guissou IP. Haematological and biochemical outline of patients with sickle cell disease SS and SC in steady state in the National Hospital Center Yalgado Ouedraogo of Ouagadougou. Mali Med. 2006; 21(1):8-11.

  19. Alapan Y, Kim C, Adhikari A, Gray KE, Gurkan-Cavusoglu E, Little JA, Gurkan UA. Sickle cell disease biochip: a functional red blood cell adhesion assay for monitoring sickle cell. Disease Res, 2016; 173:74-91.e8. PMid:27063958

    View Article      PubMed/NCBI     
  20. Weisman JK, Meeks D, Mendelsohn L, Remaley AT, Sampson M, Allen DT, Nichols J, Shet AS, Shein SL. GlycA is not a useful biomarker of inflammation in sickle cell disease. Int J Lab Hematol. 2018 ; 40(6): 704-709. PMid:30152174

    View Article      PubMed/NCBI     
  21. Allali S, Dietrich C, Machavoine F, Rignault-Bricard R, Brousse V, DE Montalembert M, Hermine O, Trovati Maciel T, Leite-de-Moraes M .Innate-like T cells in children with sickle cell disease. PLoS One. 2019; 14(6): e0219047. PMid:31251783

    View Article      PubMed/NCBI     
  22. Fredman G. Resolving inflammation and pain of sickle cell. Blood. 2019 ; 133(3): 190-191. doi: 10.1182/blood-2018-11-886259 PMid:30655305

    View Article      PubMed/NCBI     
  23. Darbari DS, Wang Z, Kwak M, Hildesheim M, Nichols j, Allen D, Seamon C, Peters-Lawrence M, Conrey A, Hall MK, Kato GJ, and Taylor VI JG . Severe Painful Vaso-Occlusive Crises and Mortality in a Contemporary Adult Sickle Cell Anemia Cohort Study. PLoS One. 2013; 8(11): e79923. doi: 10.1371/journal.pone.0079923. PMid:24224021

    View Article      PubMed/NCBI     
  24. Hou C, et al. In vivo activity of a phospholipase C inhibitor, 1-(6-((17beta-3-methoxyestra-1,3,5-trien-17-yl)amino)hexyl)-1H-pyrrole -2,5-dione (U73122), in acute and chronic inflammatory reactions. J Pharmacol Exp Ther. 2004;309:697-704. PMid:14730005

    View Article      PubMed/NCBI     
  25. Shi TJS, Liu SXL, Hammarberg H, Watanabe M, Xu ZQD, Hökfelt T. Phospholipase Cβ3 in mouse and human dorsal root ganglia and spinal cord is a possible target for treatment of neuropathic pain . Proc Natl Acad Sci U S A. 2008 ;16; 105(50): 20004-20008. doi: 10.1073/pnas.0810899105 PMid:19066214

    View Article      PubMed/NCBI     
  26. Shin J, Gireesh G, Kim SW, Kim DS, Lee S, Kim YS, Watanabe M, Shin HS. Phospholipase C β4 in the Medial Septum Controls Cholinergic Theta Oscillations and Anxiety Behaviors. J Neurosci. 2009 ; 29(49): 15375-15385. doi: 10.1523/JNEUROSCI.3126-09.2009 PMid:20007462

    View Article      PubMed/NCBI     
  27. Xie W, Samoriski GM, McLaughlin JP, Romoser VA, Smrcka A, Hinkle PM, Bidlack JM, Gross RA, Jiang H, Wu D. Genetic alteration of phospholipase C β3 expression modulates behavioral and cellular responses to μ opioids. Proc Natl Acad Sci USA. 1999 ; 96(18): 10385-10390. PMid:10468617

    View Article      PubMed/NCBI     
  28. Zhang D, XU C, Manwani D, Frenette PS. Neutrophils, platelets, and inflammatory pathways at the nexus of sickle cell disease pathophysiology. Blood. 2016 ; 127(7): 801-809. doi: 10.1182/blood-2015-09-618538 PMid:26758915

    View Article      PubMed/NCBI     
  29. Pakbaz Z, Wun T. Role of the Hemostatic System on SCD Pathophysiology and Potential Therapeutics. Hematol Oncol Clin North Am. 2014 ; 28(2): 355-374. doi: 10.1016/j.hoc.2013.11.011 PMid:24589271

    View Article      PubMed/NCBI     

Journal Recent Articles